alexmedina606 alexmedina606

03-12-2018
History

contestada

which is the process that involves glucose reacting with oxygen to produce energy, carbon dioxide, and water ?

Respuesta :

Аноним Аноним

04-12-2018

Oxygen and glucose are both reactants in the process of cellular respiration. The main product of cellular respiration is ATP; waste products include carbon dioxide and water.

Cellular Respiration Process

Answer Link

Otras preguntas

One member of the debate team is going to be chosen president. each member is equally likely to be chosen. the probability that a girl is chosen is 2/3 the prob

what is 3/5 of 21? plz answer the question

Need help on this geometry please someone ?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Satellite can focus on specific latitudes using?

Which is the best way to conserve worldwide freshwater resources? 1.increase the amount of land used to raise cattle 2.use more efficient irrigation technique

Studies of populations that reveal correlations between dietary habits and disease incidence are

What role does the House of Representative have in the impeachment process?

i will mark as brainiest you answer this easy question

A mixture from which some of the particles settle out slowly upon standing