mcpalmer16 mcpalmer16
  • 01-07-2019
  • Mathematics
contestada

what is (-5)^5/(-5)^-6

Respuesta :

altavistard
altavistard altavistard
  • 03-07-2019

Answer:

(-5)^11

Step-by-step explanation:

(-5)^5/(-5)^-6 is equivalent to  (-5)^5 * (-5)^6,

which in turn is equivalent to (-5)^11.

Answer Link

Otras preguntas

N the world's lowest-income nations, two in ten children born die by the age of
Which phrase refers to failed businesses? a. "the withered leaves of industrial enterprise" b. "serious curtailment of income" c. "no markets for their produce"
the length of a rectangle is twice its width. If the area of the rectangle is 50 ft ^2, find its perimeter.PLEASE HELP!!!!!!!!REALLY IMPORTANT HAVE TO FINISH MY
How did the Bataan Death March gets its name
How many grams of potassium hydroxide are needed to prepare 600 ml of a.450 m koh solution?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
i will mark as brainiest you answer this easy question
what is x? using the picture below and directions
A deck of cards is shuffled and three cards are delt. find the chance the second card is spade and the third card is heart
HR contains six red chili beans for green jellybeans and four blue jelly beans if we choose a jellybean then another jellybean without putting the first time ba