daniel145 daniel145
  • 03-09-2019
  • Health
contestada

Which action is required for effective communication

Respuesta :

KINGxXxONYX
KINGxXxONYX KINGxXxONYX
  • 03-09-2019

I think that to be able have effective communication, you have to relate to the person you are trying to communicate with.

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Which ordered pair is a solution to the system of equations? {2x−y=−1 {2x−4y=8 A-(−2, −3) B-(8, 2) C-(1, 3) D-(7, −5)
Find the measure of an exterior angle of each regular polygon: 100-gon.
(-6x^3+2x^2-2x)/(2x-1) how do I solve using long division?
Why was the Neolithic revolution important
How do you find the length of the hypetnyuse if you have one angle and opposite side?
Can you give me a short summary (a sentence or two) on Shakespeare’s Macbeth. And what it is.
If an employee gets potentially infectious material splashed in his eye, what should he do?
Which phrase refers to failed businesses? a. "the withered leaves of industrial enterprise" b. "serious curtailment of income" c. "no markets for their produce"
How is the creation of public policy in Russia different from that in the United States?