anagomex7646 anagomex7646

02-04-2020
History

contestada

How do American political parties and interest groups promote and undermine democratic principles?

Respuesta :

02-04-2020

Answer:lobbiests

ExplanThey are paid to convince any one of any thingation:

Answer Link

Otras preguntas

can anyone help please? Will give Brainly + 25 pts Question : Let f(x) = 2x-2 AND g(x) = 6x + 1. Write a formula for each of the following functions A. (f+g)(x

Is the following data an example of a linear function? Yes or no

Waiting stage, no electrical activity occurring

If P dollars are invested today at an annual interest rater compounded once a year, then the value of the account A after 2 years is given by the formula A - P(

The energy transfer diagram shows energy transfer in an MP3 player. Useful energy is transferred away from the MP3 player by light and what else

the managerial tools for ________ include a swot analysis, forecasting, and vrio analysis.

a party rental company has chairs and tables for rent. the total cost to rent 5 chairs and 3 tables is 34. the total cost to rent 7 chairs and 9 tables is 80. w

why are graphs of compound inequalities helpful?

the mother of a 3-year-old child tells the nurse that her child hit her doll after the mother scolded her for picking the neighbors’ flowers. which defense mech

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'