kaydenless18 kaydenless18
  • 02-04-2020
  • Mathematics
contestada

George filled 10 mugs with coffee. Each mug had 240 mL of coffee. How many liters of coffee did George use in all

Respuesta :

tanayaw55
tanayaw55 tanayaw55
  • 02-04-2020

Answer:

2.4 Liters

Step-by-step explanation:

10* 240=2400 mL. 2400 mL converted to L is 2.4

Answer Link
jensa7el
jensa7el jensa7el
  • 29-09-2020

It's 2.4 L.

-J-

HAVE A GREAT DAY SIR/MA'AM

Answer Link

Otras preguntas

1. What does the word "Imperious" mean as used in the excerpt? [RL 10.4] "And so when Okonkwo of Umuofia arrived at Mbaino as the proud and Imperious emissary o
Anyone know any websites are help in biology? if yes then answer
PLEASE HELP THIS IS TIMED. Which equation represents the difference quotient of f(x) for all nonzero values of h?
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
Who was Charlemagne's father
how far in advance should you begin searching ahead of an intersection?
PLEASE HELP!!!! I really need help​
What are two ways to find the slope of a line?​
pspsppssppss come here smart peoplehelp with either question, i just want to know how to do it​
W = 9x + 5y, solve for y​