Mroman60116 Mroman60116

02-04-2021
Mathematics

contestada

Explain with words

Why is -7^2 not equal to 49?

Please help me

Explain with words Why is 72 not equal to 49 Please help me class=

Respuesta :

dilbert21 dilbert21

02-04-2021

Because it is -(7 x 7)
Not (-7 x -7)

Answer Link

Otras preguntas

Brainliest to most helpful! Answer asap! The point (−3, 1) is on the terminal side of angle θ, in standard position. What are the values of sine, cosine, and ta

How did the triple alliance and the triple entente change during the war?

Solve for x in terms of the other matrices and/or their inverses. x=b+ax

Improved functional health can be a positive influence on which health risk/

Which factor played a role in the sudden drop after 1928? A. Lack of demand B. Lack of supply C. Lack of credit D. Lack of income

Lisa’s test grades are 79, 89, and 90. There will be one more test this year. If Lisa wants her test average to be at least 88, what is the lowest grade she can

What would be the △Y and the △X for the line that passes through the points (–5, 4) and (2, –2)

I’m confused !!! Help

Which two sets of lines in the poem illustrate that death's power is an illusion? Sonnet 10 by John Donne Death, be not proud, though some have called thee Mig

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat