Fadingstarz1 Fadingstarz1

01-12-2016
Mathematics

contestada

Which is better average: 10 of 15 free throws or 8 out of 10 free throws??

Which is a better average???

Respuesta :

Аноним Аноним

01-12-2016

8outOF10

!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Answer Link

PureHeartDirtyMind PureHeartDirtyMind

01-12-2016

8 out of 10 because that's 80% of all shots but 10 of 15 is 66%

Answer Link

Otras preguntas

The right to a trial by jury in a criminal case is outlined in which amendment?

Latin prefix opposite of mini-

The wealth and prosperity of mali and songhai were dependent on controlling the trade in

Boris has scored 80, 93, 63, 83, and 83 on his previous five tests. what score does he need on his next test so that his average (mean) is 79?

It takes 10 workers 24 hours to do a job. Fill in the chart.

Given: The coordinates of triangle PQR are P(0, 0), Q(2a, 0), and R(2b, 2c). Prove: The line containing the midpoints of two sides of a triangle is parallel to

What factors can affect mental health

Name the five transport mechanisms of the cell:

Which of the following have at least two congruent parallel bases? all that apply. A. Cylinder B. Circle C. Cone D. Cube E. None of these F

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat