ahtziry86 ahtziry86

04-08-2021
Mathematics

contestada

I suck at math ik but i need anyones help please

I suck at math ik but i need anyones help please class=

Respuesta :

ghaithgh ghaithgh

04-08-2021

Answer:

f(2)= 1

f-¹(1)= 2

f-¹(f(2))= 2

I hope I helped you^_^

Answer Link

Otras preguntas

In judith ortiz cofer's "gravity," what is elenita's main internal conflict? a.she wants an independent identity, and yet still feels a connection to others. b.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Solve the system algebraically. check your work. 2x + 5y = 10 2x + 3y = 6

Cheney is buying a house for $216,820. He made a down payment of $26,020 and will finance $190,800. He gets a 15 year fixed rate loan with a rate of 5.815%. Ho

Identify the consequences—both long-term and short-term—of the vietnam war.

Many assume that presidents with high __________ are more effective leaders.

Self-efficacy is ________.our level of confidence in our own abilitiesthe belief that we have power over our livesa state of being in which our thoughts about o

The temperature on a cloudy night is likely to be __________ those on a clear night all other factors being equal

Help plsssssssssssss

Brainliest!!!!!!!! Which person might most rely on implied meanings when they speak or write A) government official writing a report B) judge delivering a