poehbe764 poehbe764
  • 03-11-2017
  • Mathematics
contestada

There are 23 people in this class. what is the probability that at least 2 of the people in the class share the same birthday? start a new thread

Respuesta :

marslab9 marslab9
  • 03-11-2017
23/2 = 0.08
0.08 = 8/100 or 8%
Answer Link

Otras preguntas

What is the French name for the Hall of Mirrors? What is the Avenue Trianon?
Find 8 + 35 + (-76).
The learning curve describes the ________ relationship between ________ and ________
Frozen water (ice) has less density than liquid water. How does this property of water affect life on Earth?
paul has a standard deck of cards. what is the probability he will choose a 2?
What US policy was designed to handle the threat of communism spreading to the Middle East in the 1950s? A. The Kennan plan B. The Middle East doctrine C. Th
__________ is widely considered to be the founder of the professional american police department.
Multivitamin/mineral supplements should never be given to toddlers. a. True b. False
Solve for x. Assume that lines which appear tangent are tangent.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat