Seudónimo Seudónimo
  • 01-02-2016
  • Health
contestada

What is the original work under consideration in a research paper called?

Respuesta :

Аноним Аноним
  • 01-02-2016
it is the primary source
Answer Link

Otras preguntas

Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa
What is the sum of 6/10 plus 7/12
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
according to the United States constitution the president has the power to (A) negotiate treaties (B) amend the constitution (C) impeach members of congress
explain, in terms of atomic structure, why group 18 elements on the periodic table rarely form compounds
Divide the polynomial in the numerator by the trinomial in the denominator m^3-m^2-4m+1 /m^2+2m-3
What statement best describes a republic?
Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa
The process of chemical cycling is known as a biogeochemical cycle because it A. takes places over a long period of time B. withdraws the
a rectangle is 3 times as long as it is wide and its perimeter is 120 centimeters. find area.